Top » Catalog » R1b » A1299

$18.00

A1299
[A1299]

A1299
hg38 Position: ChrY:15994543..15994543
Ancestral: C
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1299_F GGTTTAACCTCGCAAAAGTATCC
Reverse Primer: A1299_R ACCCCTGGCCTTTTCTAGG
Reviews

Customers who bought this product also purchased
A1302
A1302
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1291
A1291
A1301
A1301
DNA Sample Kit
DNA Sample Kit
A1308
A1308
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies