Top » Catalog » R1b » A1304

$18.00

A1304
[A1304]

A1304
hg38 Position: ChrY:19572800..19572800
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1304_F AAGCAGTGCATGGGAACTATG
Reverse Primer: A1304_R AACCAACAGCACAACTTCCAG
Reviews

Customers who bought this product also purchased
A1301
A1301
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1291
A1291
A1299
A1299
DNA Sample Kit
DNA Sample Kit
A1308
A1308
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
1 x A2117
1 x A48
1 x A961
1 x A2183
1 x A858
1 x A1232
1 x A347
1 x A730
1 x A46
1 x A1197
1 x A898
1 x A2077
1 x A1251
$288.00
Haplogroup Info
Other products
Currencies