Top » Catalog » R1b » A1307

$18.00

A1307
[A1307]

A1307
hg38 Position: ChrY:20831203..20831203
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1307v2_F AACTCCCACTTGTATGTGAAAATATG
Reverse Primer: A1307v2_R GCATGAGCTACCGTACCTGTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A1308
A1308
A1290
A1290
A1298
A1298
A1304
A1304
A1289
A1289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A965
1 x A315
1 x A170
1 x A2137
1 x A1277
1 x A799
1 x A181
1 x A1723
1 x A2268
1 x A655
1 x A94
1 x A298
1 x A1496
1 x A546
1 x A216
1 x A133
1 x A1133
1 x A1716
1 x A1502
1 x A438
1 x A899
$378.00
Haplogroup Info
Other products
Currencies