Top » Catalog » R1b » A1308

$18.00

A1308
[A1308]

A1308
hg38 Position: ChrY:21445073..21445073
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1308_F GAAACAATAATGTTGTGAAACCAGG
Reverse Primer: A1308_R CATTGCTGGTGTTTTACCCG
Reviews

Customers who bought this product also purchased
A1299
A1299
DNA Sample Kit
DNA Sample Kit
A1307
A1307
A1290
A1290
A1298
A1298
A1304
A1304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies