Top » Catalog » R1b » A1310

$18.00

A1310
[A1310]

A1310
hg38 Position: ChrY:17143300..17143300
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1310_F CCAAGTCAGCTTGAAATCACC
Reverse Primer: A1310_R AATAATGCCCACCTGCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A447
1 x A250
1 x A441
1 x A671
1 x A579
1 x A1169
1 x A760
1 x A747
1 x A1491
1 x A1712
1 x A109
1 x A1224
1 x A162
1 x A983
$252.00
Haplogroup Info
Other products
Currencies