Top » Catalog » R1b » A1312

$18.00

A1312
[A1312]

A1312
hg38 Position: ChrY:6969046..6969046
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1312_F TGAGACATGCCCAGATGTTC
Reverse Primer: A1312_R CCAACAAGCCAGTGCTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
1 x A1301
1 x A1101
1 x A1315
1 x A1202
1 x A1286
1 x A473
1 x A233
1 x A822
1 x A89
1 x A1053
1 x A2124
1 x A341
1 x A148
1 x A716
1 x A287
1 x A1052
1 x A526
1 x A519
1 x A979
1 x A2237
$414.00
Haplogroup Info
Other products
Currencies