Top » Catalog » R1b » A1316

$18.00

A1316
[A1316]

A1316
hg38 Position: ChrY:13413442..13413442
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1316_F CACTTCAGGTCCCCTCTCAG
Reverse Primer: A1316_R TTGTTACAGCTCTGGCTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1229
$18.00
Haplogroup Info
Other products
Currencies