Top » Catalog » R1b » Z17646

$18.00

Z17646
[Z17646]

Z17646
hg38 Position: ChrY:17194994..17194994
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of Z16502
Forward Primer: Z17646_F TTGAAGAATTCCTAATGGGTGTTAG
Reverse Primer: Z17646_R GGGGGTTGAGAGAATGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies