Top » Catalog » R1b » Z17649

$18.00

Z17649
[Z17649]

Z17649
hg38 Position: ChrY:19154852..19154852
Ancestral: G
Derived: C
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of Z16502
Forward Primer: Z17649_F AAAAGCTTGCTTTCCTTTGC
Reverse Primer: Z17649_R CCAAGGCAGACAGATCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies