Top » Catalog » R1b » A1265

$18.00

A1265
[A1265]

A1265
hg38 Position: ChrY:15931789..15931789
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1265_F CAAATCTCAAACACTTTTTTTCTGAG
Reverse Primer: A1265_R GACATCTTGTTCACAAATCTTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A909
1 x A1204
1 x A628
1 x A2190
$90.00
Haplogroup Info
Other products
Currencies