Top » Catalog » R1b » A1266

$18.00

A1266
[A1266]

A1266
hg38 Position: ChrY:19798086..19798086
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1266_F GTTCTTCGTCTGTGTGACAGG
Reverse Primer: A1266_R TGCCATAGATTTTGGTAAATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
$198.00
Haplogroup Info
Other products
Currencies