Top » Catalog » R1b » A1276

$18.00

A1276
[A1276]

A1276
hg38 Position: ChrY:15418292..15418292
Ancestral: G
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1276_F AGAGCCTCCAGAAACAAACG
Reverse Primer: A1276_R CCAAGTTTCTGGGCAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A565
1 x A1333
1 x A2071
1 x A1257
1 x A570
1 x A9
1 x A211
$126.00
Haplogroup Info
Other products
Currencies