Top » Catalog » R1b » A1277

$18.00

A1277
[A1277]

A1277
hg38 Position: ChrY:16631626..16631626
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1277_F TGGTCAAAACACCATTTCCTC
Reverse Primer: A1277_R TGGACAGAGTGGGTTCTGAAG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
ZQ303
ZQ303
FGC22049
FGC22049
FGC6198
FGC6198
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies