Top » Catalog » R1b » A1277

$18.00

A1277
[A1277]

A1277
hg38 Position: ChrY:16631626..16631626
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1277_F TGGTCAAAACACCATTTCCTC
Reverse Primer: A1277_R TGGACAGAGTGGGTTCTGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1710
1 x A938
1 x A745
1 x A1719
1 x A673
$90.00
Haplogroup Info
Other products
Currencies