Top » Catalog » R1b » A1277

$18.00

A1277
[A1277]

A1277
hg38 Position: ChrY:16631626..16631626
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1277_F TGGTCAAAACACCATTTCCTC
Reverse Primer: A1277_R TGGACAGAGTGGGTTCTGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A634
1 x A2080
1 x A889
1 x A424
1 x A125
1 x A719
1 x A2076
1 x A793
1 x A997
1 x A348
1 x A758
$198.00
Haplogroup Info
Other products
Currencies