Top » Catalog » R1b » A1280

$18.00

A1280
[A1280]

A1280
hg38 Position: ChrY:12283611..12283611
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1280_F GGTTCTGGAGATAGGCGTCA
Reverse Primer: A1280_R CAGCAGCAACCATTTTAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies