Top » Catalog » R1b » A1281

$18.00

A1281
[A1281]

A1281
hg38 Position: ChrY:13446925..13446925
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1281_F CGCAAACACAAAACTGATCC
Reverse Primer: A1281_R GGGTCTGTCAGGGAATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A470
$18.00
Haplogroup Info
Other products
Currencies