Top » Catalog » R1b » A1282

$18.00

A1282
[A1282]

A1282
hg38 Position: ChrY:15783989..15783989
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1282_F ATTGGTTCACCTCCAGCAAC
Reverse Primer: A1282_R AAGTGCACCAGTAAGTTGCCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies