Top » Catalog » R1b » A1283

$18.00

A1283
[A1283]

A1283
hg38 Position: ChrY:18938535..18938535
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1283_F TTGGTTCTCTCTGAACAACTGC
Reverse Primer: A1283_R TTTTGCGATGGAATCTCAC
Reviews

Customers who bought this product also purchased
BY24084
BY24084
M7884
M7884
A1284
A1284
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1092
1 x A1269
1 x A152
1 x A1777
$72.00
Haplogroup Info
Other products
Currencies