Top » Catalog » R1b » A1285

$18.00

A1285
[A1285]

A1285
hg38 Position: ChrY:13412227..13412227
Ancestral: T
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1285_F TCATGTGGGACTGTTTCTGG
Reverse Primer: A1285_R TAGGGGCATGTGTAGCATCC
Reviews

Customers who bought this product also purchased
A1286
A1286
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies