Top » Catalog » R1b » A1289

$18.00

A1289
[A1289]

A1289
hg38 Position: ChrY:7279328..7279328
Ancestral: T
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494 > A1298
Forward Primer: A1289_F TACCCAGTGTGTGGATTTGG
Reverse Primer: A1289_R GTCTGACCCCAGCCAATG
Reviews

Customers who bought this product also purchased
A1290
A1290
A1298
A1298
A1304
A1304
A1149
A1149
A1297
A1297
A1303
A1303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
1 x A521
1 x A741
1 x A854
1 x A150
$144.00
Haplogroup Info
Other products
Currencies