Top » Catalog » R1b » A1290

$18.00

A1290
[A1290]

A1290
hg38 Position: ChrY:8120923..8120923
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1290v2_F AGGTGTAATCAAGAAAAATGGTGAC
Reverse Primer: A1290v2_R CATCCAGAATCCATTCTCCTTG
Reviews

Customers who bought this product also purchased
A1293
A1293
A1302
A1302
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1292
A1292
A1301
A1301
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A980
1 x A530
1 x A274
1 x A1263
1 x A883
1 x A275
$108.00
Haplogroup Info
Other products
Currencies