Top » Catalog » R1b » A1291

$18.00

A1291
[A1291]

A1291
hg38 Position: ChrY:8747068..8747068
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1291_F TCCAATTGGGAGTTTTCCAG
Reverse Primer: A1291_R TGAAGAACAGACATCCCCAAG
Reviews

Customers who bought this product also purchased
A1293
A1293
A1302
A1302
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1292
A1292
A1301
A1301
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
1 x A625
1 x A2253
1 x A1160
1 x A317
1 x A803
$252.00
Haplogroup Info
Other products
Currencies