Top » Catalog » R1b » A1323

$18.00

A1323
[A1323]

A1323
hg38 Position: ChrY:10149734..10149734
Ancestral: C
Derived: A
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1323_F CTTCCCTTAAACTCTGGAGAAAAGT
Reverse Primer: A1323_R GAATGATTTGTTTCACATCAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2135
1 x A613
1 x A518
1 x A144
$72.00
Haplogroup Info
Other products
Currencies