Top » Catalog » R1b » A1324

$18.00

A1324
[A1324]

A1324
hg38 Position: ChrY:8157393..8157393
Ancestral: G
Derived: A
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1324_F TGTGCTTTATTTCTGGGGATTC
Reverse Primer: A1324_R TCTTGCCTGGCTGATGTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies