Top » Catalog » R1b » A1327

$18.00

A1327
[A1327]

A1327
hg38 Position: ChrY:12898228..12898228
Ancestral: G
Derived: A
Reference: Geoffrey Grant (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Downstream DF88
Forward Primer: A1327_F TTGCTTTTGGATCAACACCTC
Reverse Primer: A1327_R AGTTGGGCGATGGTCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies