Top » Catalog » R1b » A1330

$18.00

A1330
[A1330]

A1330
hg38 Position: ChrY:11881166..11881166
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1 (not listed)
Comments: Downstream DF97
Forward Primer: A1330_F ACTCACTGAACTGATGCTTCCTC
Reverse Primer: A1330_R TAAAATTTTCATCATAAAAACTGGCAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies