Top » Catalog » R1b » A1332

$18.00

A1332
[A1332]

A1332
hg38 Position: ChrY:8180289..8180289
Ancestral: A
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1 (not listed)
Comments: Downstream DF97
Forward Primer: A1332v2_F AGGAAGCTGATGGTGTCTGC
Reverse Primer: A1332v2_R AGGCCCTTTGCCAACCAG
Reviews

Customers who bought this product also purchased
A1330
A1330
A1331
A1331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies