Top » Catalog » R1b » A1334

$18.00

A1334
[A1334]

A1334
hg38 Position: ChrY:21640499..21640499
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1a2
Comments: Downstream of Z16259. Parallel to ZS4590
Forward Primer: A1334_F ACACCATCCTGGCTAACACG
Reverse Primer: A1334_R GAGTATTTCAGGATAAAATGAAAGGATG
Reviews

Customers who bought this product also purchased
A1335
A1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1096
1 x A1315
1 x A2127
1 x A2251
$72.00
Haplogroup Info
Other products
Currencies