Top » Catalog » R1b » A1335

$18.00

A1335
[A1335]

A1335
hg38 Position: ChrY:21617833..21617833
Ancestral: G
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16259. Parallel to ZS4590
Forward Primer: A1335_F TTCTTCCCAATTTCAGATATGTCC
Reverse Primer: A1335_R GCCTGTATTCCCAGCACTTTAG
Reviews

Customers who bought this product also purchased
A1334
A1334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2135
1 x A613
$36.00
Haplogroup Info
Other products
Currencies