Top » Catalog » R1b » A1336

$18.00

A1336
[A1336]

A1336
hg38 Position: ChrY:7330529..7330529
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254. Parallel to A154
Forward Primer: A1336_F TAGAAGTCCAACGCAAATCC
Reverse Primer: A1336_R GGGAGGACCCATTCTCTCTC
Reviews

Customers who bought this product also purchased
Z16254
Z16254
S1115
S1115
Z16259
Z16259
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A88
A88
A474
A474
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A390
1 x A569
1 x A2217
1 x A610
1 x A1743
1 x A895
1 x A61
1 x A532
1 x A1256
1 x A444
1 x A861
1 x A1497
1 x A144
1 x A1709
1 x A436
$270.00
Haplogroup Info
Other products
Currencies