Top » Catalog » R1b » A1336

$18.00

A1336
[A1336]

A1336
hg38 Position: ChrY:7330529..7330529
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254. Parallel to A154
Forward Primer: A1336_F TAGAAGTCCAACGCAAATCC
Reverse Primer: A1336_R GGGAGGACCCATTCTCTCTC
Reviews

Customers who bought this product also purchased
S1121
S1121
A154
A154
A541
A541
Z16254
Z16254
S1115
S1115
Z16259
Z16259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies