Top » Catalog » R1b » A1337

$18.00

A1337
[A1337]

A1337
hg38 Position: ChrY:8641216..8641216
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254. Parallel to A154
Forward Primer: A1337_F ATTTCCAGCTGAGCAGGTTC
Reverse Primer: A1337_R GCCACATCCCACAAAGAATC
Reviews

Customers who bought this product also purchased
A474
A474
A195
A195
A153
A153
S1121
S1121
A154
A154
A541
A541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies