Top » Catalog » R1b » A1337

$18.00

A1337
[A1337]

A1337
hg38 Position: ChrY:8641216..8641216
Ancestral: G
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254. Parallel to A154
Forward Primer: A1337_F ATTTCCAGCTGAGCAGGTTC
Reverse Primer: A1337_R GCCACATCCCACAAAGAATC
Reviews

Customers who bought this product also purchased
Z16254
Z16254
S1115
S1115
Z16259
Z16259
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A88
A88
A474
A474
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A44
$18.00
Haplogroup Info
Other products
Currencies