Top » Catalog » R1b » A1338

$18.00

A1338
[A1338]

A1338
hg38 Position: ChrY:8650659..8650659
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254. Parallel to A154
Forward Primer: A1338_F ATGCATGGCAAAAGAATGAG
Reverse Primer: A1338_R TGGTTGCTATTGATGGATTCAC
Reviews

Customers who bought this product also purchased
FGC11858
FGC11858
A1340
A1340
A1339
A1339
A1337
A1337
FGC1180
FGC1180
A1336
A1336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
$54.00
Haplogroup Info
Other products
Currencies