Top » Catalog » R1b » A1

$18.00

A1
[A1]

A1
hg38 Position: ChrY:11934797..11934797
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: A1v2_F GAGGAGAAAAGAAGAATGGAAAGTAAC
Reverse Primer: A1v2_R TTGCTTTTCTAGTTCTTTTAATTGTAACA
Reviews

Customers who bought this product also purchased
AF7
AF7
CTS10
CTS10
FG1114
FG1114
AD0000008
AD0000008
AD0000007
AD0000007
AF3
AF3
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies