Top » Catalog » R1b » A1

$15.00

A1
[A1]

A1
hg38 Position: ChrY:11934797..11934797
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: A1v2_F GAGGAGAAAAGAAGAATGGAAAGTAAC
Reverse Primer: A1v2_R TTGCTTTTCTAGTTCTTTTAATTGTAACA
Reviews

Customers who bought this product also purchased
FGC10500
FGC10500
YSEQ-Alpha
YSEQ-Alpha
AD0000007
AD0000007
AF3
AF3
AF4
AF4
CLFY15753
CLFY15753
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies