Top » Catalog » R1b » A14

$18.00

A14
[A14]

A14
hg38 Position: ChrY:7786497..7786497
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b1
Comments: Found in a R1b-Z253 person
Forward Primer: A14_F CTTGGCTTCTCCCTGACTTG
Reverse Primer: A14_R TAGGAAGGAGGGCAGACATC
Reviews

Customers who bought this product also purchased
A16
A16
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
CTS4314.3
CTS4314.3
FGC17551
FGC17551
A287
A287
Z2185
Z2185
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies