Top » Catalog » R1b » A14

$18.00

A14
[A14]

A14
hg38 Position: ChrY:7786497..7786497
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b1
Comments: Found in a R1b-Z253 person
Forward Primer: A14_F CTTGGCTTCTCCCTGACTTG
Reverse Primer: A14_R TAGGAAGGAGGGCAGACATC
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
A16
A16
CTS4314.3
CTS4314.3
FGC17551
FGC17551
A287
A287
L226
L226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
1 x A2160
1 x A714
1 x A958
1 x A604
1 x A304
1 x A778
$216.00
Haplogroup Info
Other products
Currencies