Top » Catalog » R1b » A14

$18.00

A14
[A14]

A14
hg38 Position: ChrY:7786497..7786497
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b1
Comments: Found in a R1b-Z253 person
Forward Primer: A14_F CTTGGCTTCTCCCTGACTTG
Reverse Primer: A14_R TAGGAAGGAGGGCAGACATC
Reviews

Customers who bought this product also purchased
A16
A16
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC17551
FGC17551
A287
A287
CTS4314.3
CTS4314.3
A494
A494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies