Top » Catalog » R1b » A1344

$18.00

A1344
[A1344]

A1344
hg38 Position: ChrY:21822272..21822272
Ancestral: A
Derived: T
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Downstream DF21 > A426
Forward Primer: A1344_F AAGGTGTCTTGTTCTCTCAGGC
Reverse Primer: A1344_R GGGGATTGGGACATACTCTGT
Reviews

Customers who bought this product also purchased
A713
A713
A1369
A1369
A712
A712
A1343
A1343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies