Top » Catalog » R1b » A1343

$18.00

A1343
[A1343]

A1343
hg38 Position: ChrY:16632199..16632199
Ancestral: ins
Derived: del
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Downstream DF21 > A426
Forward Primer: A1343_F GAACACTGTCCCACAAATCC
Reverse Primer: A1343_R TTGAAAACCTACTTTGACAAAAATG
Reviews

Customers who bought this product also purchased
A1344
A1344
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A794
$18.00
Haplogroup Info
Other products
Currencies