Top » Catalog » R1b » A16

$18.00

A16
[A16]

A16
hg38 Position: ChrY:11928801..11928801
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b
Comments: Found in a R1b-Z253 person
Forward Primer: A16_F CCCTGTGTCATCCTTTCTCC
Reverse Primer: A16_R GCCAGTGATGGATACAGAAGC
Reviews

Customers who bought this product also purchased
DF21
DF21
A494
A494
DF49
DF49
R1b-Z253 Panel incl. L1066 and L226 (Irish Type III)
R1b-Z253 Panel incl. L1066 and L226 (Irish Type III)
DF73
DF73
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A486
1 x A1483
1 x A380
$54.00
Haplogroup Info
Other products
Currencies