Top » Catalog » R1b » A16

$18.00

A16
[A16]

A16
hg38 Position: ChrY:11928801..11928801
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b
Comments: Found in a R1b-Z253 person
Forward Primer: A16_F CCCTGTGTCATCCTTTCTCC
Reverse Primer: A16_R GCCAGTGATGGATACAGAAGC
Reviews

Customers who bought this product also purchased
DF73
DF73
DF13
DF13
L1335
L1335
FGC5660
FGC5660
FGC11134
FGC11134
FGC3249
FGC3249
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies