Top » Catalog » R1b » A17

$18.00

A17
[A17]

A17
hg38 Position: ChrY:8369671..8369671
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Found in a R1b-Z253 person
Forward Primer: A17_F CTTGCCCCCAACCTATATATCC
Reverse Primer: A17_R GTATGCTTACCATTTTGTCATGGAG
Reviews

Customers who bought this product also purchased
Z29749
Z29749
Z2188
Z2188
A6120
A6120
FGC37012
FGC37012
FGC35546
FGC35546
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies