Top » Catalog » R1b » A19

$18.00

A19
[A19]

A19
hg38 Position: ChrY:12240306..12240306
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f~
Comments: Aka S847; found in a R1b-Z253 person
Forward Primer: A19_F AATGATTCACTTTGATATTTCTGTCTC
Reverse Primer: A19_R TCCTTAGCATCAAGGAATGC
Reviews

Customers who bought this product also purchased
A17
A17
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies