Top » Catalog » R1b » A20

$18.00

A20
[A20]

A20
hg38 Position: ChrY:14604254..14604254
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Found in a R1b-Z253 person
Forward Primer: A20_F AGTGGATGCCACGTGAATG
Reverse Primer: A20_R CATTTATATGTTACCAAGACTGATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
1 x A1190
1 x A136
1 x A176
1 x A664
1 x A99
$144.00
Haplogroup Info
Other products
Currencies