Top » Catalog » R1b » A22

$18.00

A22
[A22]

A22
hg38 Position: ChrY:17150428..17150428
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Found in a R1b-Z253 person
Forward Primer: A22_F TGTCCCTTCTACCTACACCTAGAC
Reverse Primer: A22_R TGGCATGATTGTCACATTTAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies