Top » Catalog » R1b » A25

$18.00

A25
[A25]

A25
hg38 Position: ChrY:21808289..21808289
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Found in a R1b-Z253 person
Forward Primer: A25_F ATCATGATAGATAGGATAGACGGGTG
Reverse Primer: A25_R GACATGTTTTGGCGACCCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
1 x A2120
1 x A614
1 x A117
1 x A2238
1 x A850
1 x A1148
1 x A622
1 x A512
1 x A1759
1 x A584
1 x A762
$468.00
Haplogroup Info
Other products
Currencies