Top » Catalog » R1b » A30

$18.00

A30
[A30]

A30
hg38 Position: ChrY:8481041..8481041
Ancestral: A
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A30_F GGAATGGGTAACTTGCCTAAGG
Reverse Primer: A30_R AACACGGAGCCAAGTAAACCTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY155
BY155
A7793
A7793
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies