Top » Catalog » R1b » A1367

$18.00

A1367
[A1367]

A1367
hg38 Position: ChrY:19505550..19505550
Ancestral: C
Derived: A
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1367_F CCTGCTATGCTGGGGTAGTG
Reverse Primer: A1367_R AGGGCAAAGTGACGTACCTG
Reviews

Customers who bought this product also purchased
A1154
A1154
A816
A816
S11556
S11556
A476
A476
R1b-Z255 Panel
R1b-Z255 Panel
A430
A430
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies