Top » Catalog » R1b » A33

$18.00

A33
[A33]

A33
hg38 Position: ChrY:13423153..13423153
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A33_F TCAGGACCCATCTCAAAATTC
Reverse Primer: A33_R GCTTGTTCTGCTGACACTGC
Reviews

Customers who bought this product also purchased
Z251
Z251
Y16252
Y16252
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
FGC45280
FGC45280
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies